SGN Marker solcap_snp_sl_32058

SGN-M22019

Synonyms  
SL1_00sc6004_295547
SL1_00sc6004_295547_solcap_snp_sl_32058
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70617)
Chromosome
11
Position
67.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67094)
Chromosome
11
Position
71.53 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63560)
Chromosome
11
Position
88.45 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58350)
Chromosome
11
Position
50.46 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTTGCCTATTCCATGAGGCCAAAACAAGAAGTTATCAACACCTATGAGA
  
3' flanking region
CCCTTAGCTAAAACCAAAAGAAGTAAGGCAAATTCAGGCGGGCATTTGAC
SNP nucleotide
CG
SNPdb format
TTTTGCCTATTCCATGAGGCCAAAACAAGAAGTTATCAACACCTATGAGA[C/G]
CCCTTAGCTAAAACCAAAAGAAGTAAGGCAAATTCAGGCGGGCATTTGAC
  
Genomic location of solcap_snp_sl_32058  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22019 marker 22019
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)