SGN Marker solcap_snp_sl_32529

SGN-M22063

Synonyms  
SGN-U576317_snp104
SGN-U576317_snp104_solcap_snp_sl_32529
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70429)
Chromosome
3
Position
45.97 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66956)
Chromosome
3
Position
45.06 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63433)
Chromosome
3
Position
49.57 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58394)
Chromosome
3
Position
20.50 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTCAATCCTCTATTGCATAATCCTCTATTGCTCTGAGAAAAGTGAGTGAG
  
3' flanking region
GAGAGAGAGCAATGGAGATGTCAATGGCTTCTACAACTCCATGTTTCTCC
SNP nucleotide
AT
SNPdb format
TTCAATCCTCTATTGCATAATCCTCTATTGCTCTGAGAAAAGTGAGTGAG[A/T]
GAGAGAGAGCAATGGAGATGTCAATGGCTTCTACAACTCCATGTTTCTCC
  
Genomic location of solcap_snp_sl_32529  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22063 marker 22063
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)