SGN Marker solcap_snp_sl_32547

SGN-M22067

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72230)
Chromosome
10
Position
28.13 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68423)
Chromosome
10
Position
38.23 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64803)
Chromosome
10
Position
56.31 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58398)
Chromosome
10
Position
47.20 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTCAAAAGGGCCAGCTCTGTATGCATTTAAAGGGTTGGCAGGCAGATTT
  
3' flanking region
CTCCAATTGGTGTGCATATATCTCTGCTGCTTATAATGGCTGGAGGAACT
SNP nucleotide
TG
SNPdb format
TCTCAAAAGGGCCAGCTCTGTATGCATTTAAAGGGTTGGCAGGCAGATTT[T/G]
CTCCAATTGGTGTGCATATATCTCTGCTGCTTATAATGGCTGGAGGAACT
  
Genomic location of solcap_snp_sl_32547  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22067 marker 22067
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)