SGN Marker solcap_snp_sl_32597

SGN-M22074

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58405)
Chromosome
10
Position
45.45 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTTTCGATAGTGAGATGTCACTTTTCATATAAGTTATATCATGTAGAGT
  
3' flanking region
ACTATCTGAGAGTGATTACAAGAAAATGTTCTGGTGGCTAACAATGAGAA
SNP nucleotide
AG
SNPdb format
TCTTTCGATAGTGAGATGTCACTTTTCATATAAGTTATATCATGTAGAGT[A/G]
ACTATCTGAGAGTGATTACAAGAAAATGTTCTGGTGGCTAACAATGAGAA
  
Genomic location of solcap_snp_sl_32597  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22074 marker 22074
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)