SGN Marker T1706

SGN-M2209
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBG82TH
Arabidopsis best BAC match: AC011664.8
Arabidopsis position: 3.0036000
Arabidopsis identities: 0.484
Best GenBank protein hit: AAF14850.1
Evalue: 7.1e-32
Identities: 0.413
Description: putative UDP-glucosyl transferase [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49487)
Chromosome
2
Position
31.79 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47421)
Chromosome
2
Position
22.19 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-LXCHM 2007   
Map version
68 (location: 43014)
Chromosome
2
Position
9.90 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 44014
Forward primer (5'-3')
TGGACAAGCATGGGGAATTCA
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
ATTTTCCCCTTTTGCCTCCCTA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39756)
Chromosome
2
Position
18.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1706 was used as an overgo probe on plate 10 [well E12]

Plausible BAC Matches:   P067C09,   P025B07,   P114L22,   P254E21,   P023A20,   P136E02,   P042E11,   P028K10,   P025N15,   P161E16,   P042G04,   P012C13,   P305C16,   P307C18,   P303P21,   P262B22,   P048J04,   P190N21,   P188O10,   P294O17

 Overgo Sequences

A sequence
CACTCGAATCAAACGCGTTGTCAC
B sequence
AGGGCTTCTGCTTCAAGTGACAAC
AB sequence
CACTCGAATCAAACGCGTTGTCACTTGAAG
Marker sequence
GGCCAATCATGAACACATCAGATTTACTTTGGACAAGCATGGGGAATTCA
ACAATGCAAAAAATCATTTTCAACATGTTGGTTCACAACAATAAATCTGT
GAAATCAGCAGATTGGCTTATTTGCAACTCAACATATGATCTTGAACCAG
GAGCCTTCAAACTAGCACCAGAGATAGTGCCTATAGGTCCACTTTTTTCA
AACAACTCACTCGAATCAAACGCGTTGTCACTTGAAGCAGAAGCCCTTAT
ATCTTCTAGAGAATCTCCTAATTCACTAGCCGGATCGTTCTGGCCCGAGG
ACTCAACTTGTCTAGACTGGCTTGATCAACAACCATTATGCTCAGTTGTG
TATGTAGCCTTTGGGAGCTTCACAATATTCAATGAAACTCAGTTTCAAGA
ATTGGCATTAGGGCTTGAACTATCAAACAAACCATTCTTATGGGTTGTGA
GAACTACTACTCTAGATACTAAAAGTGACATTTTCTTGAAAAAAATTGAA
GAAAAAATAGGGAGGCAAAAGGGGAAAATAGTGAGTTGGGCACCACAACA
AAAGG
Genomic location of T1706  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2209 marker 2209
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)