SGN Marker solcap_snp_sl_32706

SGN-M22092

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68430)
Chromosome
12
Position
79.28 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64810)
Chromosome
12
Position
119.10 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58423)
Chromosome
12
Position
63.33 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTTTGGCATGCGCATTCTCTTCTGCAAGAAGTTCTTGCCCTGCTCCTTC
  
3' flanking region
GCTATCACAATAACCATGTGCCCATTTTCTTTGAGCCGTTTTTCAATGTA
SNP nucleotide
AG
SNPdb format
TTTTTGGCATGCGCATTCTCTTCTGCAAGAAGTTCTTGCCCTGCTCCTTC[A/G]
GCTATCACAATAACCATGTGCCCATTTTCTTTGAGCCGTTTTTCAATGTA
  
Genomic location of solcap_snp_sl_32706  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22092 marker 22092
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)