SGN Marker solcap_snp_sl_33651

SGN-M22172

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68450)
Chromosome
3
Position
45.99 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64829)
Chromosome
3
Position
47.50 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58503)
Chromosome
3
Position
45.73 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACCATACTTTTCTAGAAAGACAGCCTAAAAGTTAAAATCATGTCCTTACT
  
3' flanking region
GGCCATGAAGAACACCAATACCTCAACATCCAATGCTCAGCCAATGAAAG
SNP nucleotide
TC
SNPdb format
ACCATACTTTTCTAGAAAGACAGCCTAAAAGTTAAAATCATGTCCTTACT[T/C]
GGCCATGAAGAACACCAATACCTCAACATCCAATGCTCAGCCAATGAAAG
  
Genomic location of solcap_snp_sl_33651  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22172 marker 22172
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)