SGN Marker T1716

SGN-M2219
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBH82TH
Arabidopsis best BAC match: AB013389.1
Arabidopsis position: 5.2970000
Arabidopsis identities: 0.816
Best GenBank protein hit: AAG12816.1
Evalue: 2.8e-77
Identities: 0.811
Description: unknown protein; 6976-8939 [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39758)
Chromosome
4
Position
119.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1716 was used as an overgo probe on plate 6 [well C12]

Plausible BAC Matches:   P116I24,   P132M08

 Overgo Sequences

A sequence
TGACTGCACAGCTCTACTGATCAG
B sequence
CGGTTTAGCCCTCTTTCTGATCAG
AB sequence
TGACTGCACAGCTCTACTGATCAGAAAGAG
Marker sequence
GCTTGACTGCACAGCTCTACTGATCAGAAAGAGGGCTAAACCGAAAGAAG
AAGAAGGAGGAGGTCAAACATGGGAACCCTCGGGAAAGCAATTTACTCCC
TGGGATCCATCGTTCGAGCGACCGGCAAAGCTCTTGATCGCGTCGGAAAT
CGCCTACAAGGCAGCTCCCACATAGAGGAACACCTGTCCAGGCATCGGAC
TCTTATGAACGTATTCGATAAAGCTCCGGTGGTGGATAAGGATGTATTTG
TAGCTCCAGGTGCCTCAGTCATTGGAGATGTCCATGTGGGACGCAATTCA
TCTATTTGGTATGGATGTGTACTAAGAGGTGATGTTAACAGCATCAGTGT
CGGATCTGGTACCAATATACAGGACAACTCCCTTGTTCATGTGGCCAAAT
CAAATATAAGTCAAAAGGTGCTGCCCACCATCATAGGGAACAATGTTACT
GTTGGTCATAGTGCTGTTGTACATGGCTGCACCATTGAGGATGAGGCCTT
CATTGGTATGGGGGCCACACTGCTTGATGGTGTTCATGTAAAGAAACATG
CCATGGTTGCTGCAGGAGCCCTTGTGAAACA
Genomic location of T1716  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2219 marker 2219
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)