Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker CT258

SGN-M222

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
200
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT258 image not available
Forward sequence
TTCTTTCAATGAATCATCTGTGGTGATTTCTGACTTTGATGAAGATTCTTGAGCTGAATTTGAATCCACTGAAACTGCTGCAGTTTTGGA
CTTTCTTGGCTTGGAATTAGATTTAGAACACGAGTCATCTGATTTGGGATTAGCCAAGCTTTGGCAAATGGCTTGAAGTTTAGCATCCAC
AGAGGAATGCAAAGGCTTGAAATCAGA
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1441079e-115207 (100.0% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53467)
Chromosome
4
Position
53.27 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49340)
Chromosome
4
Position
52.56 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47277)
Chromosome
4
Position
44.63 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39039)
Chromosome
4
Position
62.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8652)
Chromosome
1
Position
98.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT258 was used as an overgo probe on plate 5 [well B8]

Plausible BAC Matches:   P175G02

 Overgo Sequences

A sequence
TCCACTGAAACTGCTGCAGTTTTG
B sequence
CCAAGCCAAGAAAGTCCAAAACTG
AB sequence
TCCACTGAAACTGCTGCAGTTTTGGACTTT
Marker sequence
TTCTTTCAATGAATCATCTGTGGTGATTTCTGACTTTGATGAAGATTCTT
GAGCTGAATTTGAATCCACTGAAACTGCTGCAGTTTTGGACTTTCTTGGC
TTGGAATTAGATTTAGAACACGAGTCATCTGATTTGGGATTAGCCAAGCT
TTGGCAAATGGCTTGAAGTTTAGCATCCACAGAGGAATGCAAAGGCTTGA
AATCAGA
Genomic location of CT258  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D222 marker 222
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)