SGN Marker solcap_snp_sl_33905

SGN-M22211

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72289)
Chromosome
3
Position
102.68 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68466)
Chromosome
3
Position
100.03 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64842)
Chromosome
3
Position
112.87 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58542)
Chromosome
3
Position
63.30 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CATTGTTTATTTATGCAACTTCTCTCATGTACCTACCCTTTCTCTTTTTC
  
3' flanking region
ATTTTCTTGCTGAAAATGATCTGATCAACATAAAGAACTGTGAAGGAGTC
SNP nucleotide
TC
SNPdb format
CATTGTTTATTTATGCAACTTCTCTCATGTACCTACCCTTTCTCTTTTTC[T/C]
ATTTTCTTGCTGAAAATGATCTGATCAACATAAAGAACTGTGAAGGAGTC
  
Genomic location of solcap_snp_sl_33905  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22211 marker 22211
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)