SGN Marker solcap_snp_sl_34292

SGN-M22291

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68480)
Chromosome
11
Position
31.71 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58622)
Chromosome
11
Position
4.23 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CGATAAATCCTCCTTACTAGCTGGTGGCAGTGAGAACACGAGGAGCGCTC
  
3' flanking region
TCAAGAAAAATCTGAGATAGCCAAATCTAATAGTCCACCATTTGTACTTG
SNP nucleotide
AG
SNPdb format
CGATAAATCCTCCTTACTAGCTGGTGGCAGTGAGAACACGAGGAGCGCTC[A/G]
TCAAGAAAAATCTGAGATAGCCAAATCTAATAGTCCACCATTTGTACTTG
  
Genomic location of solcap_snp_sl_34292  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22291 marker 22291
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)