SGN Marker solcap_snp_sl_34336

SGN-M22301

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72312)
Chromosome
11
Position
45.13 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68484)
Chromosome
11
Position
46.52 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64860)
Chromosome
11
Position
46.63 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58632)
Chromosome
11
Position
6.34 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGGTAAGCCCTACGCGTGATGGTATCCACTGTCCAGGATTAGAAGCTGAA
  
3' flanking region
TTTCTTGTGCTTTGGGGAGCATCAGGTGTCAATCTCTGTAATCAACACAC
SNP nucleotide
TG
SNPdb format
AGGTAAGCCCTACGCGTGATGGTATCCACTGTCCAGGATTAGAAGCTGAA[T/G]
TTTCTTGTGCTTTGGGGAGCATCAGGTGTCAATCTCTGTAATCAACACAC
  
Genomic location of solcap_snp_sl_34336  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22301 marker 22301
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)