SGN Marker solcap_snp_sl_34581

SGN-M22336

Synonyms  
Cd2_2755
Cd2_2755_solcap_snp_sl_34581
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70309)
Chromosome
1
Position
79.15 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66855)
Chromosome
1
Position
64.09 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63342)
Chromosome
1
Position
93.91 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58667)
Chromosome
1
Position
76.98 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAGTTGCCATGATCTTGGCCTTTGGCAATATGAGCCATTTCTTGCATAGG
  
3' flanking region
CCACCGTTGGATAGGATATCCCATTCGCTACGGAGGCGTTCGTCACGGAG
SNP nucleotide
AG
SNPdb format
CAGTTGCCATGATCTTGGCCTTTGGCAATATGAGCCATTTCTTGCATAGG[A/G]
CCACCGTTGGATAGGATATCCCATTCGCTACGGAGGCGTTCGTCACGGAG
  
Genomic location of solcap_snp_sl_34581  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22336 marker 22336
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)