SGN Marker solcap_snp_sl_34675

SGN-M22348

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72338)
Chromosome
4
Position
17.05 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68501)
Chromosome
4
Position
28.32 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58679)
Chromosome
4
Position
2.47 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATGAGACGCCAGTAAACGACACGGAAAGAGATGGGTCGAATACCGGGTCG
  
3' flanking region
ATTGGTGATAACATTGGGTACAGGGCTGACACTGTACCCAAACAATATCA
SNP nucleotide
AG
SNPdb format
ATGAGACGCCAGTAAACGACACGGAAAGAGATGGGTCGAATACCGGGTCG[A/G]
ATTGGTGATAACATTGGGTACAGGGCTGACACTGTACCCAAACAATATCA
  
Genomic location of solcap_snp_sl_34675  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22348 marker 22348
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)