SGN Marker solcap_snp_sl_34691

SGN-M22350

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72340)
Chromosome
4
Position
24.48 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68502)
Chromosome
4
Position
36.89 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58681)
Chromosome
4
Position
3.50 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTAGTTTACCAGACATAAAGCTGCCTATTAGTTCTGCTTCTGTTACGGG
  
3' flanking region
TCTAATGGTGATAAAGGGAAGCAAGTTGTTGGATCTAGTGAGCAGGAATT
SNP nucleotide
TG
SNPdb format
TCTAGTTTACCAGACATAAAGCTGCCTATTAGTTCTGCTTCTGTTACGGG[T/G]
TCTAATGGTGATAAAGGGAAGCAAGTTGTTGGATCTAGTGAGCAGGAATT
  
Genomic location of solcap_snp_sl_34691  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22350 marker 22350
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)