SGN Marker TG499

SGN-M224

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CATTAACAAGAATGTCGAGCTTCCCAAACTGTTTGACAGTTAACTCCACAACTCTTTTTGCATCTTCTTGCTTGCGGACGTCCCCTTGCA
AGCCAATTGCCTAGGGGATGTGCAAAGGAAAGTTAGACACAATAAAAGCGGTAGTCTTGATGATTATATGTTGTTTAGGGTTTCAATTTC
ATGATGGGAGCTCGGTATATAATCAAATCAAAATGCGAATGATGTATGCATTTTGTGCATGTGATCAATCACCTAATTAAGGAGATAAAA
GTAGTTACCGGAATACCAAAGGATTGAAGGTAGGAGACGGCGGAGTCGAGGACGGCCTTGCGGCGTCCCATGATGGCAACGGAGGCACCA
TGTTTGCCGAACTGAGTGGAGATCTCAAGGCCGATGCCAGAACCGCCTCCGGTCAACAGTGCTACTTTCCCTTTGAGTATGTCTGAT
Reverse sequence
AGACTGGTCCTATGTGGCTCAGATTTGAGGAAGCACTGAGCCGTTATGAAGATTTAAAAAAGTAGGCATTCACGTTTTCAATCAGTAGAC
TATTTTCTGATTGACTGACCAAATGTGTTTGGTTTGTGTTTTCAGGGAAGCAGCAGGTAGTTGTAATATTTTGTGAGCTCCAACGAACTA
TCTTTAGTTGCGTAAAAAGTAAAATTAATATCTGCAACAGCACCACCACTCCAATGTACAACAACTCATCCACTACTCATTTGTATTTAT
TCCTACCTCTGTAAAATATTATTTCTCATTTACTATCATGCTGAGAAAATTCGTATACAGCTTTTGTTTGAAATCCCAATCCAACTTTAT
TACTTCTTTTCAAATGAACTGTCAAACATTATTACGAATTTAAAAGTATACCAACTACTCTTAGGAAAATAGGTGGATCTAAGAATTAAA
AATGGGAATTGGGAATGGATCTAATAAAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1601381.7e-2562 (12.9% of RFLP seq)-
SGN-U1601381.1e-63154 (32.2% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53562)
Chromosome
7
Position
98.60 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53342)
Chromosome
7
Position
9.49 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_7 MQTL_1_Late_blight_7
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50401)
Chromosome
7
Position
65.22 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48334)
Chromosome
7
Position
95.19 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43873)
Chromosome
7
Position
91.60 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43335)
Chromosome
7
Position
84.90 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40877)
Chromosome
7
Position
105.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36584
Forward primer (5'-3')
ATGTCGAGCTTCCCAAACTG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TCAGGGAAGCAGCAGGTAGT
Digested band sizes (using EcoRI)
Solanum pennellii TA56
900
Solanum lycopersicum TA209
500
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40066)
Chromosome
7
Position
97.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8655)
Chromosome
7
Position
89.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8660)
Chromosome
7
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8659)
Chromosome
7
Position
112.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG499 was used as an overgo probe on plate 7 [well C9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CACCATGTTTGCCGAACTGAGTGG
B sequence
ATCGGCCTTGAGATCTCCACTCAG
AB sequence
CACCATGTTTGCCGAACTGAGTGGAGATCT
Marker sequence
CATTAACAAGAATGTCGAGCTTCCCAAACTGTTTGACAGTTAACTCCACA
ACTCTTTTTGCATCTTCTTGCTTGCGGACGTCCCCTTGCAAGCCAATTGC
CTAGGGGATGTGCAAAGGAAAGTTAGACACAATAAAAGCGGTAGTCTTGA
TGATTATATGTTGTTTAGGGTTTCAATTTCATGATGGGAGCTCGGTATAT
AATCAAATCAAAATGCGAATGATGTATGCATTTTGTGCATGTGATCAATC
ACCTAATTAAGGAGATAAAAGTAGTTACCGGAATACCAAAGGATTGAAGG
TAGGAGACGGCGGAGTCGAGGACGGCCTTGCGGCGTCCCATGATGGCAAC
GGAGGCACCATGTTTGCCGAACTGAGTGGAGATCTCAAGGCCGATGCCAG
AACCGCCTCCGGTCAACAGTGCTACTTTCCCTTTGAGTATGTCTGAT
Genomic location of TG499  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D224 marker 224
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)