SGN Marker solcap_snp_sl_35323

SGN-M22433

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72387)
Chromosome
3
Position
53.10 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58764)
Chromosome
3
Position
50.24 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTCCACCAAGTGAGGTTGATGACAACACTGGTGTCTCTGATCATCAGAAT
  
3' flanking region
TGGCATATGAATATCATCTTGATTCTTGTCCCCGTGCTGAACGAATATCG
SNP nucleotide
TC
SNPdb format
CTCCACCAAGTGAGGTTGATGACAACACTGGTGTCTCTGATCATCAGAAT[T/C]
TGGCATATGAATATCATCTTGATTCTTGTCCCCGTGCTGAACGAATATCG
  
Genomic location of solcap_snp_sl_35323  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22433 marker 22433
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)