SGN Marker solcap_snp_sl_35344

SGN-M22439

Synonyms  
SGN-U582610_snp835
SGN-U582610_snp835_solcap_snp_sl_35344
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70472)
Chromosome
3
Position
53.65 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67000)
Chromosome
3
Position
45.99 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63475)
Chromosome
3
Position
47.50 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58770)
Chromosome
3
Position
50.42 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTTATGGCAAGATTTTATGCCTTCTTCTCCCTCTGCTCATGATTCCACT
  
3' flanking region
TGGCTGCTAATTATAATTCTTCTTATTATGAAGAAATCATATCTAGTCAT
SNP nucleotide
AT
SNPdb format
ATTTATGGCAAGATTTTATGCCTTCTTCTCCCTCTGCTCATGATTCCACT[A/T]
TGGCTGCTAATTATAATTCTTCTTATTATGAAGAAATCATATCTAGTCAT
  
Genomic location of solcap_snp_sl_35344  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22439 marker 22439
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)