Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker T1751

SGN-M2244
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBK46TH
Arabidopsis best BAC match: AL021684.1
Arabidopsis position: 5.2930000
Arabidopsis identities: 0.720
Best GenBank protein hit: BAA91548.1
Evalue: 1.1e-12
Identities: 0.285
Description: unnamed protein product [Homo sapiens]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39770)
Chromosome
3
Position
69.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1751 was used as an overgo probe on plate 7 [well C1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTTCTCAGCTTTCGGATCAAGGAC
B sequence
GCACTCTTCCCTTCTTGTCCTTGA
AB sequence
CTTCTCAGCTTTCGGATCAAGGACAAGAAG
Marker sequence
GCCCAAGAAGGTCTTCATTTTCCTAAATGATTTTCGGGCAAAAACAGAAG
AAGTAATGTTTCTGAATGCTGAATAGCAGCTGAAAAAAAATAAATAGATT
CTTGGAATTGGGTTGAGAAGCTGTTGAGGCTGGTGGCGTTGGTATCTGAC
ATTGAAATATTTCAATTTTGGTTTGTTGGAAGATAATTATAATGAGCAGA
AAAGATGCCAAGAATTGGCCAAATCATCATCTTTCTACCGCAGGATATAT
TCAGAGGTAGAGGAGATAGGATGGGAGCACCTTGTTAGATTTGGGAAAGA
CCTAAGACTTCTCAGCTTTCGGATCAAGGACAAGAAGGGAAGAGTGCACA
TTCTGCAGATAACTTTGGATGGAACATATCCTAACCATCCGCCTTCATTA
TCAGCGGATGTGCCTTATCTCTTCAATTTGAAATGGTCAATTAACTCAAG
ACTGAAAGATGTTATCCAACAGTTTCAGAAGCATCTTGAGAAGCTTCAGG
ACTTTTGGAATCTAATGGATGACATTGACCACTCTCTTTTGGTTTCTGAT
CTACGATATCCTCAACGTGCTTTGTCACA
Genomic location of T1751  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2244 marker 2244
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)