Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker T1752

SGN-M2245
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 9.01
Tomato EST read: TRZBK71TH
Arabidopsis best BAC match: AB005230.2
Arabidopsis position: 5.0210000
Arabidopsis identities: 0.800
Best GenBank protein hit: BAA03923.1
Evalue: 4.5e-86
Identities: 0.932
Description: endo-xyloglucan transferase [Lycopersicon esculentum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39771)
Chromosome
1
Position
114.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1752 was used as an overgo probe on plate 3 [well B4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATGACGCTTGTTGGTGGAGACTCA
B sequence
CAGTGACAACACCAGTTGAGTCTC
AB sequence
ATGACGCTTGTTGGTGGAGACTCAACTGGT
Marker sequence
TACACAAACACTGGTCTCTGATTGGATTTGTTTTTCTCACCATGGGTATC
ATAAAAGGAGTTTTATTTACTATTGTTTTGATTAATTTGTCACTTGTTGT
ATTTTGTGGGTATCCTATAAGGCCAGTAAATGTGCCCTTTTGGAAAAACT
ATGAGCCAAGTTGGGCTAGTCACCATATTAAGTTCCTCAATGGTGGTACC
ACTACTGATCTTATTCTCGACAGATCTTCAAGAGCTGGATTTCAGTCAAA
GAAATCATATCTGTTTGGGCATTTCAGTATGAAAATGACGCTTGTTGGTG
GAGACTCAACTGGTGTTGTCACTGCATTTTACCTGTCATCGAATAATGCA
GAGCACGATGAGATAAATTTTGAATTTTT
Genomic location of T1752  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2245 marker 2245
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)