SGN Marker CT106

SGN-M225

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
TACAACAGTGTCCTGTCAACCCACTCCCTTCTTGAGCACACTGATGTAAGGTTCCACCACAGAGGTTGAGACCTTACAACAGTGTCCTGT
CAACCCACTCCCTTCTTGAGCACACTGATGTTGCAATTCTTCTTGACAATGAGGCTATCTATGACATCTGCAGGCGCTCATTGGACATTG
AGCGTCCCACATACACCAATCTTAACCGTCTTATTTCACAGGTTATCTCTTCACTTACTGCTTCTTTGAGGTTTGATGGAGCCCTGAATG
TTGATGTCAATGAATTTCAGACCAACCTTGTTCCCTACCCCAGAATTCATTTTATGCTTTCATCCTATGCTCCTGTCATTTCAGCTGAGA
AAGCCTACCATGAGCAGCTGTCAGTTGCAGAGATCACCAACAGTGCTTTTGAGCCATCTTCCATGATGGTCAAGTGTGATCCTCGCCACG
GCAAGTATATGGC
Reverse sequence
CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAAACAAGCACGTTTAACTTTTCATAGCAGATGAATTCATGTCAGCAAACAAG
ACCCCATTAAAATACAAAATAGCAGGGATGTATCTAAGGGCAGCATTTGAAAAACCCCCAAAGGAAAATACAATCCAACAAACAAAGCCA
TCCCGGGTTTAGAACTCCTCGGGATCATCATCCTCTCCTTCTTCCAATTCAGCACCAACCTCCTCGTAATCCTTCTCCAAAGCAGCTAAA
TCTTCACGGGCTTCACTGAACTCGCCTTCTTCCATACCCTCACCAACATACCAGGGGACAAAAGCACGCTTTGCATACATGAGATCGAAC
TTGGGGTCAATGCGTGAGAAGACCTCAGCAACACTGGTTGAGTTGGAAATCATACATACAGCCCTTTGCACCTTGGCAAGA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1456283.3e-0532 (6.9% of RFLP seq)+
SGN-U1432025.3e-0747 (10.2% of RFLP seq)+
SGN-U1432032.2e-0947 (10.2% of RFLP seq)+
SGN-U1432041.4e-1037 (8.0% of RFLP seq)+
SGN-U1603741.4e-1037 (8.0% of RFLP seq)+
SGN-U1603661.4e-1037 (8.0% of RFLP seq)+
SGN-U1603701.4e-1037 (8.0% of RFLP seq)+
SGN-U1603706.1e-1947 (10.2% of RFLP seq)+
SGN-U1603746.1e-1947 (10.2% of RFLP seq)+
SGN-U1603666.1e-1947 (10.2% of RFLP seq)+
SGN-U1432046.1e-1947 (10.2% of RFLP seq)+
SGN-U1603696.6e-25149 (32.2% of RFLP seq)+
SGN-U1603683e-36168 (36.3% of RFLP seq)+
SGN-U1456283.1e-39377 (81.4% of RFLP seq)+
SGN-U1603685.1e-41152 (32.8% of RFLP seq)+
SGN-U1603662.4e-92174 (37.6% of RFLP seq)+
SGN-U1432025e-112355 (76.7% of RFLP seq)+
SGN-U1432031e-112392 (84.7% of RFLP seq)+
SGN-U1603673e-113209 (45.1% of RFLP seq)+
SGN-U143204393 (84.9% of RFLP seq)+
SGN-U160370393 (84.9% of RFLP seq)+
SGN-U160374370 (79.9% of RFLP seq)+
SGN-U1603685e-0755 (12.5% of RFLP seq)-
SGN-U1456282.7e-30150 (34.0% of RFLP seq)-
SGN-U1713531.1e-35151 (34.2% of RFLP seq)-
SGN-U1603743e-39116 (26.3% of RFLP seq)-
SGN-U1432057.9e-43175 (39.7% of RFLP seq)-
SGN-U1603711.4e-50180 (40.8% of RFLP seq)-
SGN-U1432035.8e-56213 (48.3% of RFLP seq)-
SGN-U1603674e-177352 (79.8% of RFLP seq)-
SGN-U143204404 (91.6% of RFLP seq)-
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53757)
Chromosome
4
Position
12.10 cM
Confidence
uncalculated
Protocol
RFLP

2_Isobutylthiazole_content_ibt4_1 2_Methylthio_ethanol_content_meo4_1 Dry_matter_weight_dmw4_1 6_Methylhept_5_en_2_one_content_mhn4_1 Lycopene_content_lyc4_1 2_Methylbut_2_enal_content_bea4_1Color_L_L4_1 Color_a_a4_1Hexanal_content_hxa4_1 3_Methylpentan_1_ol_content_mno4_1 Elasticity_ela4_1 Color_b_b4_1Firmness_fir4_1
Tomato QTL map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38958)
Chromosome
2
Position
11.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38959)
Chromosome
2
Position
99.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8662)
Chromosome
2
Position
13.10 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8661)
Chromosome
2
Position
84.50 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8663)
Chromosome
12
Position
54.00 cM
Confidence
I
Protocol
RFLP
Subscript
C


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT106 was used as an overgo probe on plate 6 [well D1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ACTCCCTTCTTGAGCACACTGATG
B sequence
CTGTGGTGGAACCTTACATCAGTG
AB sequence
ACTCCCTTCTTGAGCACACTGATGTAAGGT
Marker sequence
TACAACAGTGTCCTGTCAACCCACTCCCTTCTTGAGCACACTGATGTAAG
GTTCCACCACAGAGGTTGAGACCTTACAACAGTGTCCTGTCAACCCACTC
CCTTCTTGAGCACACTGATGTTGCAATTCTTCTTGACAATGAGGCTATCT
ATGACATCTGCAGGCGCTCATTGGACATTGAGCGTCCCACATACACCAAT
CTTAACCGTCTTATTTCACAGGTTATCTCTTCACTTACTGCTTCTTTGAG
GTTTGATGGAGCCCTGAATGTTGATGTCAATGAATTTCAGACCAACCTTG
TTCCCTACCCCAGAATTCATTTTATGCTTTCATCCTATGCTCCTGTCATT
TCAGCTGAGAAAGCCTACCATGAGCAGCTGTCAGTTGCAGAGATCACCAA
CAGTGCTTTTGAGCCATCTTCCATGATGGTCAAGTGTGATCCTCGCCACG
GCAAGTATATGGC
Genomic location of CT106  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D225 marker 225
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)