Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker T1758

SGN-M2250
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.04
Tomato EST read: TRZBK96TH
Arabidopsis best BAC match: AC021043.4
Arabidopsis position: 1.0616000
Arabidopsis identities: 0.731
Best GenBank protein hit: AAD27848.1
Evalue: 1.1e-69
Identities: 0.753
Description: peroxisomal targeting signal type 2 receptor [Arabidopsis thaliana]
Comment: compare with TRXAE23TH
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39773)
Chromosome
3
Position
73.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1758 was used as an overgo probe on plate 7 [well D2]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P306K17,   P306A11,   P012C22,   P020H14,   P183I10

 Overgo Sequences

A sequence
ACGGGAGAGTTCACATTCTTCAGC
B sequence
GGTCCGTTTGGATTGAGCTGAAGA
AB sequence
ACGGGAGAGTTCACATTCTTCAGCTCAATC
Marker sequence
GCCTTTTACATCGGGAAAGTAAATCACCGGCAACAATCAAATCAGCGCCG
ACCGCTGTCCGCCGTCCGCCGACCGCCTAAGATGCCGGTATTTAAAACTC
CATTTAACGGTTACTCCGTAAAATTCAGTCCCTTCTACGAAAACAAACTA
GCTGTGGCCACTGCGCAGAATTTCGGCATCCTTGGTAACGGGAGAGTTCA
CATTCTTCAGCTCAATCCAAACGGACCGGTATCGGAACTTGCGGCTTTTG
ACACAGCTGATGGAGTTTACGACGTTTGCTGGTCGGAAGCTCACGATTCA
CTTGTTATTGCTGGAAGTGGCGATGGTTCTGTGAAACTCTATGACCTTTC
TTTGCCTCCCACCAATAACCCTATTCGTTCTTTTAAGGAACATACACGGG
AAGTTCACTCTGTTGACTATAATACCGTGAGAAAAGATTCCTTCTTGTCA
GCGTCTTGGGATGATACTGTGAAGCTATGGACTGTTGATAGAAATGCCAG
TGTAAGGACTTTTAAGGAACATGCTTATTGTGTCTATTCCGCTGCTTGGA
ATC
Genomic location of T1758  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2250 marker 2250
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)