SGN Marker solcap_snp_sl_36544

SGN-M22612

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72475)
Chromosome
3
Position
108.19 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68595)
Chromosome
3
Position
105.08 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64976)
Chromosome
3
Position
120.31 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58943)
Chromosome
3
Position
64.42 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AACATCACTCCCATCTGCATCCAAAAATTCCTCAGCGGCATCATCTTCTA
  
3' flanking region
TGTCTTCTTCTTCTTCTTCTTTGGTTTCTTCGAGGACTTCATCTTATTCA
SNP nucleotide
AC
SNPdb format
AACATCACTCCCATCTGCATCCAAAAATTCCTCAGCGGCATCATCTTCTA[A/C]
TGTCTTCTTCTTCTTCTTCTTTGGTTTCTTCGAGGACTTCATCTTATTCA
  
Genomic location of solcap_snp_sl_36544  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22612 marker 22612
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)