SGN Marker T1777

SGN-M2263
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBM79TH
Arabidopsis best BAC match: AC006434.5
Arabidopsis position: 1.1414000
Arabidopsis identities: 0.621
Best GenBank protein hit: AAF87113.1
Evalue: 2.4e-45
Identities: 0.533
Description: conceptual translation [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 43015)
Chromosome
5
Position
38.60 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 44015
Forward primer (5'-3')
ATGGTGTGGTATTGACTTATGAAC
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
CAGATTTCAGCTTTCCCTTGTAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39777)
Chromosome
5
Position
105.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1777 was used as an overgo probe on plate 11 [well E12]

Plausible BAC Matches:   P166A02,   P148C07

 Overgo Sequences

A sequence
CAGCATTACGGAGAAGAGGATAGG
B sequence
AGCAGCCCTTTTGTTGCCTATCCT
AB sequence
CAGCATTACGGAGAAGAGGATAGGCAACAA
Marker sequence
GAGATGGTGTGGTATTGACTTATGAACCCAAGTTCAGTAGCAATTTGGCT
AGAATTCTTCCAGGAATTCACCCTTATTTTGGTGTGAAACTTGAAGCAAA
ATTGCTACTTTTTAATCCAAAGCCAGAAATGCTATTAGAAGGTGAGGTCG
TTAAAGTTGGCCAGCAGTCTATTCACATAGTTGTTCTTGGTTTTTCTTCG
GCTGTCATAGCAGATGAGGACATTCGAGAAGATTTCAAGTATAAAATTAA
ACACGGGAAAGAAGTTTTTGTTAGCAGATCAAACAAGAAACACAGGATCA
AAGTGGGAACTACTCTACGGTTCTCAGTTAAGAATTTTGATGAAGAGATA
CTACATATGTGTGGGTCATTAATTCCAGATAACACAGGAAATATTCAATG
GTTGGAAACGAAAGCAGAAGAGTCTCAAGCTTACAGCATTACGGAGAAGA
GGATAGGCAACAAAAGGGCTGCTGAATTGCTTGAGCCAGATAACTTAGTA
CCCTACAAGGGAAAGCTGAAATCTGAAAATCATATTAAGAAATC
Genomic location of T1777  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2263 marker 2263
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)