SGN Marker solcap_snp_sl_36902

SGN-M22649

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72502)
Chromosome
1
Position
60.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68614)
Chromosome
1
Position
46.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64994)
Chromosome
1
Position
65.34 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58980)
Chromosome
1
Position
70.36 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTGGATTCATTTTTCTTCATTCCGAATTCCTCACACGCTGATCCAGCATG
  
3' flanking region
AAAAATAATAGGTCAATGCTATTAATCGCATTCTTGGTTGCCATTAGACT
SNP nucleotide
TC
SNPdb format
GTGGATTCATTTTTCTTCATTCCGAATTCCTCACACGCTGATCCAGCATG[T/C]
AAAAATAATAGGTCAATGCTATTAATCGCATTCTTGGTTGCCATTAGACT
  
Genomic location of solcap_snp_sl_36902  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22649 marker 22649
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)