SGN Marker T1782

SGN-M2268
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBP32TH
Arabidopsis best BAC match: AC007504.3
Arabidopsis position: 1.0900000
Arabidopsis identities: 0.414
Best GenBank protein hit: AAD43166.1
Evalue: 1.8e-37
Identities: 0.407
Description: Putative BURP domain containing protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49492)
Chromosome
1
Position
88.19 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47426)
Chromosome
1
Position
145.12 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39778)
Chromosome
1
Position
156.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1782 was used as an overgo probe on plate 3 [well A2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAAAGCCATGGAAGACACACTGAG
B sequence
TGGAGCCTCACATTCTCTCAGTGT
AB sequence
GAAAGCCATGGAAGACACACTGAGAGAATG
Marker sequence
GCAGCAAAGGCACATATCCATTCATCATCCCATATGGATCATATTGATCC
TTCTTTAAGAGTTTTCTTCCTAATAAATGATCTAAAGATAGGGAAAACAA
TAACTGTCTCCTTCCCAAGAAGAGATCTTTCTTCTTCTCCGAGTTTCTTG
CCAAAAGAAGAAGCTGATTCCATTCCATTTTCACAAAAGGAACTCCCAAA
CCTCCTTCAACGTTTCTCATTCTCTCGAAACTCTCCACAGGGGAAAGCCA
TGGAAGACACACTGAGAGAATGTGAGGCTCCACATATTAAGGGAGAGACA
AAGTACTGTGCCACATCCGCGGAGGCAATGCTTGATTTTGTTCAAGGAAT
CATGGGAGAGAAAACTCAATTCAAAGCTCTGTCCACAACTCATTTCTCAA
ACTCAACTCCCCCACTTCAAGAGTATACTATTTTGGATGCTCCTCAAGAA
GTAGAAACTCCCAAGATGGTGGCATGTCATACCATGCCTTACGCTTACGC
GATTTTCTACTGTCATTACACAATTAGCAAGAGCAAAGTGTTTAAGGTTT
CATTAAGGGGTGAAAATGGTGATAGAGTGGAAGCAATTGCTGTTTGTCAT
TTGGATA
Genomic location of T1782  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2268 marker 2268
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)