SGN Marker T1784

SGN-M2269
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.01.01
Tomato EST read: TRZBP44TH
Arabidopsis best BAC match: AB005231.2
Arabidopsis position: 5.1040000
Arabidopsis identities: 0.827
Best GenBank protein hit: BAB10143.1
Evalue: 9.8e-71
Identities: 0.880
Description: tryptophan synthase beta chain [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49493)
Chromosome
12
Position
63.56 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47427)
Chromosome
12
Position
94.87 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-LXCHM 2007   
Map version
68 (location: 43016)
Chromosome
12
Position
60.80 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 44016
Forward primer (5'-3')
TGAAAATGCATACACTTGGTC
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
GATTGAGGGGGTTGGGGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39779)
Chromosome
12
Position
96.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1784 was used as an overgo probe on plate 4 [well E6]

Plausible BAC Matches:   P296I01,   P210H04,   P261C05,   P057E10,   P118E03

 Overgo Sequences

A sequence
CCAAGGTGCTATTCAGTTTGCGAG
B sequence
TATCAACCCCTCAGACCTCGCAAA
AB sequence
CCAAGGTGCTATTCAGTTTGCGAGGTCTGA
Marker sequence
GAGACACCGCAAGCATGACTCCTTTAATGAAAATGCATACACTTGGTCAT
GACTTCATACCGGATCCCATCCATTCCGGGGGTCTCCGTTACCACGGCAT
GGCACCACTGATATCACACGTCTATGAACTCGGATTCATGGAAGCAATAT
CAATTCCGCAGATTGAATGTTTCCAAGGTGCTATTCAGTTTGCGAGGTCT
GAGGGGTTGATACCAGCACCAGAACCAACGCATGCTATAGCCGCTACTAT
AAGGGAAGCTCTAAGATGTAAAGAGACCGGAGAATCGAAAGTTATACTCA
TGGCAATGTGTGGACATGGACATTTTGATTTGTCATCTTACGATAAGTAT
TTGCAGGGAAGCATGGTTGATTTGTCCTTCTCAGAAGAGAAAATAAAAGC
CTCACTCGCGAAGATACCACAACCAGTATCATAAGTTGATCCAAGTCGAG
GAGACGATGAAAATAGGAGGTACGTCGTGGAATTTGGTTTGTACTTTTCT
CCACGAATAATGTTTTCGTAGTTCTGCCAAGTTGAAGAATAACATGCCCC
CAACCCCCTCAATCTTTTGATCGAATAATATTCGATACAATTAGTTTGTA
GCTTTGTAAGTTGTTG
Genomic location of T1784  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2269 marker 2269
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)