Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker TG134

SGN-M227

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2500
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
ATAACTATGTTATATTATCTTTTCTGCTACACAATTGTCACAGAAGTGTTTCATTGTTAATGTTGCCTTCATTGTAATGTTACTGTAGGC
GAATGTGTGTTTTTGGCTTTCATAGCCCTATTCATGAACAAGCACAACATGGATGGTAATTTGGACCCCCTTTTCCTCTCCATACCCTCT
TAACCCTCCTAGAATGCCCCGATCATTTCATTGTGTTTTTTTTTTATAGAAATAATTTGAAGATTCTCAAAGAACTAACCGGGACTTGGA
ATTGTGATATGCTTGAAACTTATGTGATAATTCGGGACAGGAGCAGCCAAACTCCTCTTGTTAGTACCTTTAAAGATTGTTTACTTTGTT
AGATGCTTATAGCCGGCTAAGAAACTGCTTTCTTTATAGTCTATTCAAGTCTAAATAGTACTGTAATTTGTTAGTTACTTAGGCTTAGTC
TTGGTGATCTGTTTAAAATATCAGCTGTATACCAATGATCTCTTAGTACAG
Reverse sequence
CGCATCAGTAAAAAAGAATCAATTTTTCCCAATTAAAAAAAAAAAAGCAAAAGAATCTAAAGACAACCCATTTCAAAGACGCATGTGAAG
TCCAAACCCCACCAATAAAAAACTAACCAATTTCACCAGAAAACTTCACCGAACTCAGCCACCACTATAAAGTAAGGGACTGTAATCTTG
AAAAATGATTTGGGGGTGTTGAAGATAAAGAAAAAAGCTCACTCTTTTTCAGAGGTTGGTGAGAAAAGGGTCACACAAGATTAGAGCAGG
CATGTGCTGGGGCATTTGTTGGAGATTTGGGTCCTCCTCTCATTTTGCCCCATTATCTACACACAAAGGCGCAGGTTTTTACAGTAAAGA
AAATTTTCCAATTGGACAAAAAATATGTTATTTTTTTTTAGTTATTATAACAAAAGTCTCTTGTTTTTTCCTTCAAAACATAAGGAAAGT
GGTCTTTTATTTTTATAGCCAAATGGAGATGGATGATAATTAATTGGAAGATTATGTAATTAATTGGAAGATT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1714379.7e-0934 (6.5% of RFLP seq)-
SGN-U1714371.8e-59115 (22.0% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53175)
Chromosome
3
Position
72.92 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_3 MQTL_2_Late_blight_3 MQTL_3_Late_blight_3
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39902)
Chromosome
3
Position
110.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Pepper-AC99   
Map version
34 (location: 8677)
Chromosome
3
Position
118.61 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8674)
Chromosome
3
Position
83.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8679)
Chromosome
3
Position
40.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG134 was used as an overgo probe on plate 4 [well B6]

Plausible BAC Matches:   P187G12,   P061L22,   P262I04,   P270H08,   P055P11,   P138L01,   P280I15,   P318C22,   P201C17

 Overgo Sequences

A sequence
CCCTTTTCCTCTCCATACCCTCTT
B sequence
GCATTCTAGGAGGGTTAAGAGGGT
AB sequence
CCCTTTTCCTCTCCATACCCTCTTAACCCT
Marker sequence
ATAACTATGTTATATTATCTTTTCTGCTACACAATTGTCACAGAAGTGTT
TCATTGTTAATGTTGCCTTCATTGTAATGTTACTGTAGGCGAATGTGTGT
TTTTGGCTTTCATAGCCCTATTCATGAACAAGCACAACATGGATGGTAAT
TTGGACCCCCTTTTCCTCTCCATACCCTCTTAACCCTCCTAGAATGCCCC
GATCATTTCATTGTGTTTTTTTTTTATAGAAATAATTTGAAGATTCTCAA
AGAACTAACCGGGACTTGGAATTGTGATATGCTTGAAACTTATGTGATAA
TTCGGGACAGGAGCAGCCAAACTCCTCTTGTTAGTACCTTTAAAGATTGT
TTACTTTGTTAGATGCTTATAGCCGGCTAAGAAACTGCTTTCTTTATAGT
CTATTCAAGTCTAAATAGTACTGTAATTTGTTAGTTACTTAGGCTTAGTC
TTGGTGATCTGTTTAAAATATCAGCTGTATACCAATGATCTCTTAGTACA
G
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG134  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D227 marker 227
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)