SGN Marker T1787

SGN-M2272
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.13
Tomato EST read: TRZBP60TH
Arabidopsis best BAC match: AC006929.3
Arabidopsis position: 2.1580000
Arabidopsis identities: 0.701
Best GenBank protein hit: AAD21510.1
Evalue: 1.3e-46
Identities: 0.743
Description: putative carboxypeptidase [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49494)
Chromosome
11
Position
49.36 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47428)
Chromosome
11
Position
77.53 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39783)
Chromosome
11
Position
63.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1787 was used as an overgo probe on plate 3 [well B8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CACCAAAAGCCCACATGTTCTGGT
B sequence
GAACTTCTGTAGTACCACCAGAAC
AB sequence
CACCAAAAGCCCACATGTTCTGGTGGTACT
Marker sequence
TTATGTTGAAGTTACACCAAAAGCCCACATGTTCTGGTGGTACTACAGAA
GTTCATACAGAGTTGAAGATCCAAATAAGCCATGGCCAATAATTCTTTGG
TTACAGGGTGGACCTGGAGCATCAGGAGTTGGAATTGGGAATTTTGAAGA
AATTGGGCCATTGGACACTAATCTTAAACCTAGGAATTCAACTTGGTTGA
GAAAAGCTGATCTTCTTTTTGTAGATAATCCAGTTGGAACAGGATATAGT
TTTGTGGAGGACAAAAAATTATTTGTGAAAACAGATGTGGAGGCAGCAAC
AGATTTGACCACATTATTAATTGAAATATTTAATAAAAATCAAAGTCTTC
AACAAAGTCCTTTATATATAGTAGCAGAATCTTATGGAGGAAAATATGCT
GTTACTCTTGCACTTTCAACCTTAAAAGCTATTCAATCTGGGAAATTAAA
ACTCAAACTTGGAAGAATGGC
Genomic location of T1787  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2272 marker 2272
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)