SGN Marker solcap_snp_sl_3746

SGN-M22727

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72534)
Chromosome
4
Position
76.24 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68633)
Chromosome
4
Position
84.76 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65016)
Chromosome
4
Position
120.60 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59058)
Chromosome
4
Position
60.53 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGAACTCACCAGCAGGCATAATGCAGGTACTGCTTCAAGAATTTCAGGTC
  
3' flanking region
TTGCAGCTCATAACACAACTTGGTTCTCCCTATTGTTCCCTTATCAGATT
SNP nucleotide
CG
SNPdb format
AGAACTCACCAGCAGGCATAATGCAGGTACTGCTTCAAGAATTTCAGGTC[C/G]
TTGCAGCTCATAACACAACTTGGTTCTCCCTATTGTTCCCTTATCAGATT
  
Genomic location of solcap_snp_sl_3746  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22727 marker 22727
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)