SGN Marker T1790

SGN-M2275
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 11.07.03
Tomato EST read: TRZBP76TH
Arabidopsis best BAC match: AC011914.7
Arabidopsis position: 1.1341000
Arabidopsis identities: 0.670
Best GenBank protein hit: AAF07343.1
Evalue: 6.7e-33
Identities: 0.666
Description: peroxidase ATP23b [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39785)
Chromosome
5
Position
46.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1790 was used as an overgo probe on plate 11 [well E9]

Plausible BAC Matches:   P144K03,   P207B16,   P186J04,   P060M21,   P120P24,   P118J24,   P147F10

 Overgo Sequences

A sequence
CAAATCCAGAGACTTATGTGAATG
B sequence
CTCTTTCTCACTTCTCCATTCACA
AB sequence
CAAATCCAGAGACTTATGTGAATGGAGAAG
Marker sequence
GAGACAACAATGAAACATCAATGGACAATATTACTCCAAATTTATTTGAT
AATTCATATTATCATGTCTTACTTAAAGGTGAAGGACTCATAAATTCAGA
TCAACAACTTTATTCAAGTTTTCTTGGGATTCAAACTAAAAAAATTGTTG
AAAAATATGCAACAAATACAATTGCATTTTTTGAACAATTTGCTGAATCA
ATGGTCAAAATGGGAAATATTACAAATCCAGAGACTTATGTGAATGGAGA
AGTGAGAAAGAGTTGTAGGTTTGTGAACACATAGAAGAAGAAAAAAAATA
TATTGAGTTAATTATGTAATATTATTATACACACAAAAAAAAATTGTTTG
GGTTTTGTATTTGATTTTGTTTGTAATTTCTCAAAAAGAAAAATTATGAT
GTTATTAATAAGAATTATTGAAGCTTTTGTTATAATGTAATGTGCCACGT
GTGAATTTAGATAAGTCTATAGTTGAATGATGATACAGAATATCGACGAA
AATAGTGAAATATTTTAATGTATGAACTTATATTGGTTTGGATTTTATAC
AAACTCTTTGAAATT
Genomic location of T1790  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2275 marker 2275
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)