SGN Marker T1794

SGN-M2277
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBP93TH
Arabidopsis best BAC match: AB007645.1
Arabidopsis position: 5.3030000
Arabidopsis identities: 0.678
Best GenBank protein hit: BAB09017.1
Evalue: 2.5e-35
Identities: 0.704
Description: strong similarity to unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49495)
Chromosome
4
Position
60.67 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47429)
Chromosome
4
Position
85.82 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39786)
Chromosome
4
Position
97.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1794 was used as an overgo probe on plate 6 [well F10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ACTACCTCGTTTTCCGGTACCTTC
B sequence
GTGAACCCTGATTCCTGAAGGTAC
AB sequence
ACTACCTCGTTTTCCGGTACCTTCAGGAAT
Marker sequence
GAAAATCTCGGAGAGAGAAAGCACATGGTGTTTGTTTCCTCCGGCGTTCA
TTCGGCAAAATGATCTCTCTCACCTAGTCGGAGCTCAACTACCTCGTTTT
CCGGTACCTTCAGGAATCAGGGTTCACACATTCCGCATTTGCTTTACGAT
ATGAGGCAGGGATCAATAAGAGCCCAATAGATGGAAATTTAGTTCCTCCT
GGTGGTCTGGTTACCTTTGTACAAAAGGGAATCCAATATCTTGAATTGGA
AGCAAATTTGACCAATGATGACACAGATATGGACGAAGACTTCCAGTTTA
TACAGCCCATTGATCTTATCACCAAGGATGTCTATGAACTACATAAAATT
ATC
Genomic location of T1794  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2277 marker 2277
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)