SGN Marker solcap_snp_sl_38178

SGN-M22779

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72571)
Chromosome
1
Position
54.05 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68663)
Chromosome
1
Position
46.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65045)
Chromosome
1
Position
72.14 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59110)
Chromosome
1
Position
71.95 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TACTAAATTAAAACATCATTTTTCAGATGAGGAGATTGTCATAATTCCTC
  
3' flanking region
AGGGAAGTGAAAATATGTCACAATAAGTACACTGCATTTTGCTGTTATAA
SNP nucleotide
AG
SNPdb format
TACTAAATTAAAACATCATTTTTCAGATGAGGAGATTGTCATAATTCCTC[A/G]
AGGGAAGTGAAAATATGTCACAATAAGTACACTGCATTTTGCTGTTATAA
  
Genomic location of solcap_snp_sl_38178  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22779 marker 22779
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)