Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_3841

SGN-M22799

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72586)
Chromosome
4
Position
89.18 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68674)
Chromosome
4
Position
102.11 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65055)
Chromosome
4
Position
144.51 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59130)
Chromosome
4
Position
62.77 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTTATTGTTTTGAGCAAGTCAAGCATAGAGAAGAAAACTCATACAAGTTA
  
3' flanking region
ATTTAGAGAAGGTGTGAGCCAAATATCAGATGTAGATTTTAATGGCCTTA
SNP nucleotide
AG
SNPdb format
GTTATTGTTTTGAGCAAGTCAAGCATAGAGAAGAAAACTCATACAAGTTA[A/G]
ATTTAGAGAAGGTGTGAGCCAAATATCAGATGTAGATTTTAATGGCCTTA
  
Genomic location of solcap_snp_sl_3841  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22799 marker 22799
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)