SGN Marker solcap_snp_sl_38520

SGN-M22817

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65064)
Chromosome
12
Position
61.39 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59148)
Chromosome
12
Position
44.74 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAGGTTAAAAAAGCATTAATCTAGAAAAAGAAGACCTCCTATAAGCAACT
  
3' flanking region
TGAAAGTTTTCACATGACGATAATGAAGCTTGTATGTGTAACTTTCTACC
SNP nucleotide
AG
SNPdb format
GAGGTTAAAAAAGCATTAATCTAGAAAAAGAAGACCTCCTATAAGCAACT[A/G]
TGAAAGTTTTCACATGACGATAATGAAGCTTGTATGTGTAACTTTCTACC
  
Genomic location of solcap_snp_sl_38520  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22817 marker 22817
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)