SGN Marker solcap_snp_sl_3901

SGN-M22889

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59220)
Chromosome
4
Position
63.03 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGAAGAAGACTCAGATGATGGTTTCATTGCAACTCTTAAAAGCACAAAGA
  
3' flanking region
ACAGAAAGCCTCTTGATGTTTCTAATGGCTTAGTGAAATTGTAGATGAGA
SNP nucleotide
CG
SNPdb format
TGAAGAAGACTCAGATGATGGTTTCATTGCAACTCTTAAAAGCACAAAGA[C/G]
ACAGAAAGCCTCTTGATGTTTCTAATGGCTTAGTGAAATTGTAGATGAGA
  
Genomic location of solcap_snp_sl_3901  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22889 marker 22889
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)