Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_3941

SGN-M22924

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72658)
Chromosome
4
Position
90.27 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68726)
Chromosome
4
Position
104.96 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65107)
Chromosome
4
Position
152.76 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59255)
Chromosome
4
Position
63.13 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCTCCACCTTTCCCAATTATGTTCTCCTCTTTTAAACACTCCAAAACATC
  
3' flanking region
TCAGCTCTGAAATCAAGTTTCTGGAATGCTGTTAACTTCCAAAGTTGCGA
SNP nucleotide
CG
SNPdb format
GCTCCACCTTTCCCAATTATGTTCTCCTCTTTTAAACACTCCAAAACATC[C/G]
TCAGCTCTGAAATCAAGTTTCTGGAATGCTGTTAACTTCCAAAGTTGCGA
  
Genomic location of solcap_snp_sl_3941  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22924 marker 22924
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)