SGN Marker solcap_snp_sl_3969

SGN-M22964

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72682)
Chromosome
4
Position
90.55 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68744)
Chromosome
4
Position
105.91 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65124)
Chromosome
4
Position
152.76 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59295)
Chromosome
4
Position
63.26 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGTCTAACTGGTTATTCAACAATTTGCTCACGGATCTATCTGCTAGAACC
  
3' flanking region
CAGCTCATGCTGTTGCTGGAACAATGCTTTTCTCGGTGGCGGCTACCACG
SNP nucleotide
TG
SNPdb format
GGTCTAACTGGTTATTCAACAATTTGCTCACGGATCTATCTGCTAGAACC[T/G]
CAGCTCATGCTGTTGCTGGAACAATGCTTTTCTCGGTGGCGGCTACCACG
  
Genomic location of solcap_snp_sl_3969  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22964 marker 22964
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)