Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_3977

SGN-M22977

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68748)
Chromosome
4
Position
106.54 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65128)
Chromosome
4
Position
151.39 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59308)
Chromosome
4
Position
63.32 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGTTTTTTTATCATATTGCTCTGAAAAACAAAATATGGAGTGATGGAGCA
  
3' flanking region
TGTGGACAAGTAAACTCCACCCCATCCAAATAATACACCAGAAAAGTACA
SNP nucleotide
TG
SNPdb format
TGTTTTTTTATCATATTGCTCTGAAAAACAAAATATGGAGTGATGGAGCA[T/G]
TGTGGACAAGTAAACTCCACCCCATCCAAATAATACACCAGAAAAGTACA
  
Genomic location of solcap_snp_sl_3977  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22977 marker 22977
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)