SGN Marker solcap_snp_sl_4000

SGN-M23011

Synonyms  
SGN-U567626_snp662
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72704)
Chromosome
4
Position
91.09 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68764)
Chromosome
4
Position
106.54 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65143)
Chromosome
4
Position
154.12 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59342)
Chromosome
4
Position
63.37 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTGGTTCATGTTTGTCATTTTATGGGAGTTATGCATAGAGATCTTAAACC
  
3' flanking region
GAAAATTTCTTGATGGTTAGTAAAGATGATGATTCTCCATTGAAGGCTAC
SNP nucleotide
TG
SNPdb format
GTGGTTCATGTTTGTCATTTTATGGGAGTTATGCATAGAGATCTTAAACC[T/G]
GAAAATTTCTTGATGGTTAGTAAAGATGATGATTCTCCATTGAAGGCTAC
  
Genomic location of solcap_snp_sl_4000  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23011 marker 23011
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)