SGN Marker solcap_snp_sl_4005

SGN-M23017

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72709)
Chromosome
4
Position
91.36 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68767)
Chromosome
4
Position
106.54 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65146)
Chromosome
4
Position
154.80 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59348)
Chromosome
4
Position
63.39 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGATATTTTTAAAATTGGATGATTTTTTTTCGAGTGATTTTGGGCGTTCC
  
3' flanking region
TTTTCCTGGGTTTATTGAGTTTCTTCCTCTGTTTGATCTGACCAATGCAC
SNP nucleotide
AG
SNPdb format
AGATATTTTTAAAATTGGATGATTTTTTTTCGAGTGATTTTGGGCGTTCC[A/G]
TTTTCCTGGGTTTATTGAGTTTCTTCCTCTGTTTGATCTGACCAATGCAC
  
Genomic location of solcap_snp_sl_4005  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23017 marker 23017
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)