SGN Marker solcap_snp_sl_4011

SGN-M23022

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72712)
Chromosome
4
Position
91.36 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68769)
Chromosome
4
Position
106.86 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65148)
Chromosome
4
Position
154.80 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59353)
Chromosome
4
Position
63.42 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AATCTAATTTTTACACATCCTTCTATCAGACCTTAAAAAAGCGGAAAGAC
  
3' flanking region
TCATCGTTGTCATCATCCATATCAAAATACTTGAAGCCAATATCATTGTC
SNP nucleotide
CG
SNPdb format
AATCTAATTTTTACACATCCTTCTATCAGACCTTAAAAAAGCGGAAAGAC[C/G]
TCATCGTTGTCATCATCCATATCAAAATACTTGAAGCCAATATCATTGTC
  
Genomic location of solcap_snp_sl_4011  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23022 marker 23022
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)