SGN Marker solcap_snp_sl_4021

SGN-M23028

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72717)
Chromosome
4
Position
91.63 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65152)
Chromosome
4
Position
159.53 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59359)
Chromosome
4
Position
63.45 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTTTTATCTTCAACCATTACTAGTATTACTGTTAGAAAAGCTGCAAAAT
  
3' flanking region
CTTAGTGATTATATGTGGCATTCCAATTCTAGGTTTTTTTTAGACTGTAA
SNP nucleotide
TG
SNPdb format
TCTTTTATCTTCAACCATTACTAGTATTACTGTTAGAAAAGCTGCAAAAT[T/G]
CTTAGTGATTATATGTGGCATTCCAATTCTAGGTTTTTTTTAGACTGTAA
  
Genomic location of solcap_snp_sl_4021  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23028 marker 23028
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)