Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_4029

SGN-M23039

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59370)
Chromosome
4
Position
63.47 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTTAATGGGTTTTGAATCAGGAACAGTAAAGTTGGTTGTTTAATTGATT
  
3' flanking region
TTGATTAATATGATCCCAATTTGAGATTTTTCGCCATCTTTCGGCCGCAA
SNP nucleotide
AT
SNPdb format
ATTTAATGGGTTTTGAATCAGGAACAGTAAAGTTGGTTGTTTAATTGATT[A/T]
TTGATTAATATGATCCCAATTTGAGATTTTTCGCCATCTTTCGGCCGCAA
  
Genomic location of solcap_snp_sl_4029  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23039 marker 23039
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)