SGN Marker solcap_snp_sl_4036

SGN-M23048

Synonyms  
2189_1_164_b
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72727)
Chromosome
4
Position
91.90 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68781)
Chromosome
4
Position
107.17 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59379)
Chromosome
4
Position
63.51 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGACCAGCAGAGCTAGCAAGTCTGATGGTTTTAGTTGTGTTGATCATACC
  
3' flanking region
TAATGGTATGAACCTTGTGGGTTTGGCCTTGGTCCACTTGCTGACAAGTT
SNP nucleotide
AG
SNPdb format
TGACCAGCAGAGCTAGCAAGTCTGATGGTTTTAGTTGTGTTGATCATACC[A/G]
TAATGGTATGAACCTTGTGGGTTTGGCCTTGGTCCACTTGCTGACAAGTT
  
Genomic location of solcap_snp_sl_4036  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23048 marker 23048
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)