SGN Marker solcap_snp_sl_40366

SGN-M23050

Synonyms  
SGN-U576068_snp460
SGN-U576068_snp460_solcap_snp_sl_40366
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70427)
Chromosome
1
Position
106.05 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66954)
Chromosome
1
Position
95.39 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59381)
Chromosome
1
Position
84.41 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGCTGCCAAAAAGTATATTGAAACTGCTGTAAACTCTGCTGGTGCTTCAA
  
3' flanking region
GAAATCTGCTTTTAAAGCAATTTCTTCTCACTCTAAAAAGGTTCATCCTT
SNP nucleotide
TC
SNPdb format
TGCTGCCAAAAAGTATATTGAAACTGCTGTAAACTCTGCTGGTGCTTCAA[T/C]
GAAATCTGCTTTTAAAGCAATTTCTTCTCACTCTAAAAAGGTTCATCCTT
  
Genomic location of solcap_snp_sl_40366  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23050 marker 23050
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)