SGN Marker solcap_snp_sl_4038

SGN-M23051

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72729)
Chromosome
4
Position
91.90 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68782)
Chromosome
4
Position
107.17 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65155)
Chromosome
4
Position
156.84 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59382)
Chromosome
4
Position
63.51 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTCCCTATTTGATCCTTCACTTGTAGATTGAATGTGTTATTTCTCCCTGG
  
3' flanking region
GGTATTGGGCATGTTGTTCCATATACTCCATCTACAAATGAGTTTCTTCT
SNP nucleotide
CG
SNPdb format
CTCCCTATTTGATCCTTCACTTGTAGATTGAATGTGTTATTTCTCCCTGG[C/G]
GGTATTGGGCATGTTGTTCCATATACTCCATCTACAAATGAGTTTCTTCT
  
Genomic location of solcap_snp_sl_4038  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23051 marker 23051
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)