SGN Marker solcap_snp_sl_40488

SGN-M23058

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72733)
Chromosome
1
Position
107.98 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68785)
Chromosome
1
Position
97.61 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65158)
Chromosome
1
Position
164.96 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59389)
Chromosome
1
Position
85.06 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGCTTTCCATTCAAGACACCTGTCTTGCAATAAGCTCTTGCAGTAGACAT
  
3' flanking region
GGACTTACTTCATTCCAAGCATTTACAATGGGGTCATATCGCCAGACAGA
SNP nucleotide
AG
SNPdb format
AGCTTTCCATTCAAGACACCTGTCTTGCAATAAGCTCTTGCAGTAGACAT[A/G]
GGACTTACTTCATTCCAAGCATTTACAATGGGGTCATATCGCCAGACAGA
  
Genomic location of solcap_snp_sl_40488  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23058 marker 23058
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)