SGN Marker solcap_snp_sl_4055

SGN-M23063

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72737)
Chromosome
4
Position
92.18 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68787)
Chromosome
4
Position
107.17 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59394)
Chromosome
4
Position
63.58 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTGTGATGACAAGAATAACTGATAGGGCCAAAAGAATGATACAAGAGAG
  
3' flanking region
GTATTATCAAGATGCACGCCCTCCGCGTCTTTTCTCTTCTAGAATTGCAG
SNP nucleotide
AG
SNPdb format
TTTGTGATGACAAGAATAACTGATAGGGCCAAAAGAATGATACAAGAGAG[A/G]
GTATTATCAAGATGCACGCCCTCCGCGTCTTTTCTCTTCTAGAATTGCAG
  
Genomic location of solcap_snp_sl_4055  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23063 marker 23063
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)