SGN Marker solcap_snp_sl_40582

SGN-M23066

Synonyms  
SGN-U581653_snp1600
SGN-U581653_snp1600_solcap_snp_sl_40582
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59397)
Chromosome
1
Position
85.55 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGTTGGTAATGATGATGATGATGAAGAGGAAAATGGAAGCCAAAAGAGGG
  
3' flanking region
TTATTGGCAATGTTTGACATTGTATGGGAAGTTAATAGATGAAGGTATTG
SNP nucleotide
CG
SNPdb format
AGTTGGTAATGATGATGATGATGAAGAGGAAAATGGAAGCCAAAAGAGGG[C/G]
TTATTGGCAATGTTTGACATTGTATGGGAAGTTAATAGATGAAGGTATTG
  
Genomic location of solcap_snp_sl_40582  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23066 marker 23066
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)